cellmix Co., Ltd. (Law Firm Gyeong River et al., Counsel for the defendant-appellant)

Defendant 1 and three others (Law Firm Lee & Lee, et al., Counsel for the defendant-appellant)

January 23, 2014

Seoul Central District Court Decision 2011Gahap21711 Decided October 19, 2012

1.The judgment of the first instance, including the preliminary claims added at the trial, shall be amended as follows:

A. The Defendants paid to each of the Plaintiff the amount of KRW 300 million and the amount calculated by Defendant 1 from April 30, 201; Defendant 2 from April 2, 2011; Defendant UBcare from March 23, 2011; Defendant UBBio from March 24, 2011; and Defendant UBBio from March 24, 2011 to March 20, 2014; and 5% per annum from March 20, 2014 to the day of full payment; and 20% per annum from the following day to the day of full payment.

B. The plaintiff's remaining main claims and conjunctive claims are all dismissed.

2. The total costs of the lawsuit are ten minutes, which are assessed against the Plaintiff, and the remainder is assessed against the Defendants, respectively.

3. Paragraph 1(a) of this Article may be provisionally executed.

1. Purport of claim

The defendants shall pay to each plaintiff 5 billion won and 20% interest per annum from the next day of the delivery of a copy of the complaint of this case to the day of full payment (the plaintiff shall be liable to the defendants for damages based on the original illegal act, and the plaintiff shall be liable to the main claim, and the plaintiff shall be added to the conjunctive claim against the defendant 1, 2, and U2Bio.).

2. Purport of appeal

Of the judgment of the court of first instance, the part against the plaintiff falling under the order to pay is revoked. The defendants shall pay to each plaintiff the amount of KRW 2 billion and the amount calculated by 20% per annum from the day following the delivery of a copy of the complaint of this case to the day of full payment.

1. Basic facts

A. Status of the parties

1) The Plaintiff Company is a gene testing specialist who provides genetic testing services, such as genetic testing services, to the national hospital and clinical center by using genetic molecular diagnostic technology, etc. established on August 22, 2002.

2) Defendant 1 was a person who was employed by the Plaintiff Company as a vice president in September 2004 and worked as the vice president in charge of the main sentence of the Plaintiff Company, and was employed as the substantial vice president of Defendant U2Bio (hereinafter “Defendant U2Bio”) established by Defendant 2 from January 2009 from January 1, 2009.

3) Defendant 2 served as the representative director of UBcare Co., Ltd. (hereinafter “Defendant UBcare”), from around 1994 to October 2009, and established UBcare on January 2, 2009 during the said period, and currently served as the representative director.

4) around August 2004, Nonparty 2 entered the Plaintiff Company and was engaged in the management of claims by the Plaintiff Company’s mechanical business department, etc., and retired from January 2009. From January 9, 2009 to January 2009, Nonparty 2 was actually employed as an agent for the management support office.

B. Patent right of the Plaintiff Company

On October 23, 2006, the Plaintiff filed a patent registration (patent registration number omitted); however, on October 24, 2009, the patent right was extinguished and registered as of October 24, 2009.

C. Defendant 1’s occupational breach of trust

1) In August 2008, Defendant 2 commenced negotiations to merge with Nonparty 1, the representative director of the Plaintiff Company, and Defendant 2, who had been notified by Nonparty 1, proposed that Nonparty 1 take over only the Plaintiff Company’s domain business unit in a separate amount of KRW 1 billion on November of the same year, but was refused. Defendant 1 arranged Nonparty 3, the vice-chief, the vice-chief, Nonparty 4, Nonparty 5, and Defendant 2, the vice-chief, as well as Defendant 2, for the first time of December of the same year.

2) On December 20, 2008, Defendant 1 recommended the employees of Nonparty 1’s medical business division of the Plaintiff Company to retire from the Plaintiff Company and to leave the Plaintiff’s company as well as Defendant U2Bio to be established by Defendant 2, and requested Nonparty 1 to prepare a written commitment of permission for severance from employment to the effect that he/she should receive unemployment benefits even. Defendant 1 demanded Nonparty 1 to take a written commitment of permission for severance from employment from January 2009 from Nonparty 1 to December 31, 2008.

3) The nine members, including Nonparty 2, etc., of the personnel of the medical business division of the Plaintiff Company, retired from the Plaintiff Company en bloc in January 2009, and then retired from the Defendant U2Bio with major business assets, such as documents on genetic tests conducted based on the patent technology of this case owned by the Plaintiff Company, cost table for genetic test transactions, and unit price table for test items.

4) In addition, around January 20, 2009, Defendant 1 instructed the above non-party 2 to take two PC devices equivalent to KRW 8 million, which are genetic testing equipment used by the Plaintiff Company, for use in Defendant U2Bio, and let the non-party 2 take out the above machines on February 1, 2009.

D. Establishment of Defendant 2’s U2Bio

Defendant 2 established U2Bio on January 2, 2009. At the time of its establishment, Nonparty 6 was the representative director, but in substance, Defendant 2 operated U2Bio and was appointed as the representative director on November 10, 2009, and Defendant 1 was working as the vice president.

E. Closure of the Plaintiff Company

On January 31, 2009, Nonparty 1 declared that the representative director of the Plaintiff Company was no longer able to operate the Plaintiff Company for all employees.

F. Progress of a criminal case against Defendant 1 and Defendant 2

1) Defendant 1’s occupational breach of trust and night building theft teachers, and Defendant 2’s occupational breach of trust were prosecuted as Seoul Eastern District Court 2010dan3029, respectively, and the said court rendered a judgment of not guilty on January 19, 2012, with respect to Defendant 1 and Defendant 2.

2) Accordingly, Defendant 1 and the prosecutor appealed to Seoul Eastern District Court 2012No188, and the above court reversed the judgment below against Defendant 1 on July 26, 2012 and sentenced Defendant 1 to one year of imprisonment and three years of suspended execution, and acquitted Defendant 2.

3) Defendant 1 and the Prosecutor appealed to the Supreme Court Decision 2012Do10055, but the final appeal was all dismissed on December 27, 2012, and the said judgment became final and conclusive.

[Reasons for Recognition] Unsatisfy, Gap evidence 1 and 3, Gap evidence 4-1, 2, 4, 14, 16, 18 through 22, 27, 32, 36, 37, 52, 53, 54, 57, 64, 65, 79, 86, 87, 89, 97, Gap evidence 7 and 13, Eul evidence 37, and the purport of the whole pleadings

2. Judgment on the primary cause of the claim

A. Whether the liability for damages occurred

1) Summary of the parties’ assertion

A) Summary of the Plaintiff’s assertion 1)

(1) The liability for damages caused by joint tort by Defendant 1 and Defendant 2

Defendant 1 and Defendant 2, in collusion, retired from office to U2Bio by all employees of the Plaintiff Company’s main business department, and obtained various business data and experimental equipment, etc. managed and used by the Plaintiff Company, and eventually discontinued the Plaintiff Company, thereby having U2Bio acquire the aforementioned human resources assets and the Plaintiff Company acquire a considerable amount of time, effort and expenses, and obtain pecuniary benefits equivalent to the amount of the market exchange price, and thereby causing property damage equivalent to the amount of the Plaintiff Company. Accordingly, the said Defendants are liable for all damages incurred by the Plaintiff Company in accordance with Article 760 of the Civil Act.

Shebin's liability for damages under the Commercial Act of Defendant UBcare

Defendant 2 was in office as the representative director of UBcare at the time of the above illegal act, and Defendant 2 was refused to offer a merger and acquisition proposal with Nonparty 1 as part of Defendant UBcare’s business. Defendant 2 planned to deduct the Plaintiff Company’s patent technology and separately established UBcare, and started genetic testing and had Nonparty 7 and Nonparty 8, an employee of UBcare, take charge of the finance and personnel affairs of UBcare. As such, Defendant 2’s act is objectively conducted the business affairs of UBcare. Thus, Defendant 2’s act against the Plaintiff Company, as it is objectively conducted the business affairs of UBcare, is liable for damages pursuant to Articles 389(3) and 210(2) of the Commercial Act.

【Defendant U2Bio’s employer’s responsibility

Since Defendant 1 is the vice president of Defendant U2Bio, and Defendant 2 served as the representative director of Defendant U2Bio, there exists a command and supervision relationship between Defendant 1, Defendant 2, and Defendant U2Bio, and the act of occupational breach of trust between Defendant 1 and Defendant 2 is recognized as relevant to the execution of affairs. Thus, Defendant 1 and Defendant 2 bears the employer’s responsibility for joint tort under Article 756 of the Civil Act against Defendant 1 and Defendant 2.

B) Summary of the Defendants’ assertion

(1) Defendant 1

Since Defendant 1’s occupational breach of trust did not result in the Plaintiff Company’s bankruptcy or the Plaintiff Company’s damage, Defendant 1’s act and the Plaintiff’s damage cannot be deemed as having a causal relationship.

Doz. 2

Defendant 2, in collusion with Defendant 1, did not participate in the act of occupational breach of trust by Defendant 1, and only employed an employee of the Plaintiff Company after confirming a written permission for severance from office by the Plaintiff Company’s employees.

【Defendant UBcare

Even if the liability of Defendant 2’s above tort is recognized, this is merely an individual act committed by Defendant 2, who had prior to his retirement, in the process of establishing a company that he would act after his retirement, regardless of the Defendant UBcare, and does not constitute the Defendant UBcare’s business performance. Defendant UBcare cannot be deemed as part of Defendant UBcare’s business since it did not conduct an official inspection for the acquisition and merger of the Plaintiff Company or discussed at the board of directors, or there is no circumstance to regard Defendant UBcare’s business performance. Thus, Defendant UBcare cannot be held liable to Defendant UBcare as to Defendant 2’s act.

x Defendant U2Bio

Defendant 1 was the shareholder and executive officers of the Plaintiff Company at the time of the aforementioned illegal act, and was not the representative agency or employee of Defendant U2Bio, and thus, Defendant 1 cannot be held liable for the above illegal act by Defendant U2Bio.

2) Determination

A) Determination as to the claim against Defendant 1

(i)Recognitions

According to the above evidence, the following facts and circumstances are recognized.

① Using genetic molecular diagnostic techniques, the Plaintiff Company provided genetic testing services and other services to the national hospital and clinical center. Among them, the market share in the same industry was over the majority. However, since April 2008, the payment of wages to its employees was delayed, and the financial difficulties occurred due to excess of debt, etc. around October 2008.

② As seen earlier, Nonparty 1, the representative director of the Plaintiff Company, upon the completion of the discussions on acquisition and merger with Defendant 2 on November 2008, notified the Plaintiff Company’s employees of the circumstances that it is difficult to maintain the financial status and may proceed with corporate rehabilitation procedures (at the time, Nonparty 1 did not notify the Plaintiff Company’s employees of bankruptcy), and made efforts to avoid financial difficulties, such as attracting investment funds and extending the term of loan of financial institutions with Defendant 1, the vice president of the Red Business Department (the vice president of the Plaintiff Company). However, around January 10, 209, Defendant 1 and the employees who want to resign from employment were many. Accordingly, preparing a written permission of severance from employment under a labor contract that would be unable to work in the same company for three years after retirement from office, the said written permission of severance from employment was reported to the employees to be employed until the acquisition is completed or additional funds are introduced and issued.

③ Nonparty 1, who had tried to overcome the financial crisis through the acquisition and merger of the Plaintiff Company at the time, or the attraction of investment funds, did not know at all that Defendant 2, who was the counter party to the takeover negotiations, had established a new company for the same type of business and employed the Plaintiff company employees, and did not know of such fact, she believed Defendant 1’s horse that “a means to prevent employees, such as separation from employment, and to solve the problem of overdue wages,” and prepared a written permission for severance.

④ On the other hand, Defendant 1 did not notify Nonparty 1 of his departure from employment, etc. to Nonparty 1 at all, and arranged Defendant 2 and Medididi business personnel as soon as possible.

⑤ On the other hand, Nonparty 1 was unable to have pressure, such as delayed payment of wages, against employees, and expected employees were unable to operate the company any longer under the circumstances where they were unable to submit a comprehensive letter of apology and work at work. On January 31, 2009, Defendant 1 also stated that the investigation agency made a statement that, regardless of the existence of the Plaintiff company’s ability to pay wages, the Plaintiff company’s main business affairs should not be immediately suspended, if the employees who retired from office due to Defendant U2Bio do not exist in the Plaintiff company.

④ Nonparty 2, as an agent for the Plaintiff Company’s domain business, was in charge of computerized program management, customer’s claim, and outstanding amount management, and was ordered by Defendant 1 to leave his office and set up it. On January 9, 2009, Nonparty 2: (a) left his office due to Defendant U2Bio and worked as an agent for the management support center; (b) was listed on the list 187 group in the Plaintiff Company; (c) as a result of genetic testing conducted based on the patent technology of this case owned by the Plaintiff Company, the documents, cost table for genetic testing transactions, and unit price table for testing items were stored in his external hard disc and carried out to the Defendant U2Bio office.

7) The Plaintiff Company’s computer program network access to each individual ID for each employee, set up items that can be seen only as IDs, and Nonparty 2 was able to access all information by taking charge of the management of the said computer center.

8) Nonparty 2 was a person who is a trade secret that is not disclosed to the outside, in an investigative agency’s electronic program management, credit for each customer, management of outstanding amount, genetic testing unit price, and discount rate, and the unit price calculation file in the trading unit price table is separately designated.

9) The Plaintiff Company traded with national hospitals, etc. for several years after its establishment, calculated business data, such as optimal trading rates and conditions using the instant patent, etc., and accumulated them by storing them in the electronic computer center in the Company. Since the Plaintiff Company had a large number of inspection techniques accumulated by using patent technology, etc., it would have been meeting cost competitiveness compared with other companies at the time of 2008, and only the other party or the president of the hospital, etc., who actually trades with each other, was aware of the content thereof.

(10) In particular, Defendant 2 established U2Bio and prepared all equipment, human resources, etc. to conduct genetic testing to Defendant 1, in addition to the business network and funds of UBcare for which he was the representative director. Nonparty 2, under the direction of Defendant 1, who was able to establish U2Bio, was ordered to take out the list, etc. of the above business partners in order to utilize it for the work of U2Bio. The employees of the Plaintiff Company's U2Bio business division, including Nonparty 2, including the Plaintiff 2, are in charge of the same kind of work that the Plaintiff Company had previously performed even after leaving his position due to U2Bio, so it seems that the Plaintiff Company's business partners were made as U2Bio and managed its detailed contents.

1) Defendant U2Bio newly established to perform the same work as the Plaintiff Company needs to be informed of not only technical capabilities but also information of customers, amount presented or contracted to each customer, terms and conditions of delivery, etc. In order to take precedence over the Plaintiff Company’s competitive advantage, there is a high possibility of gaining competitive benefits by inducing the Plaintiff Company’s customers to their transaction partner if using the list of transaction partners, unit price, discount rate, transaction terms, inspection results, etc. accumulated by the Plaintiff Company.

(12) On January 20, 2009, Defendant 1 instructed Nonparty 2 to bring PCM machinery in custody of the Plaintiff Company to Defendant U2Bio and used it for the inspection work, and Nonparty 1 viewed Nonparty 2 as the Plaintiff’s office in early February 2009, and returned the PC machinery again to Nonparty 2 as the Plaintiff’s office.

(13) Defendant 1 left the position of the employees of the main body of the Plaintiff Company to U2Bio, and had Defendant U2Bio acquire all kinds of business data and experimental equipment, research technology, sales, etc. managed and used by the Plaintiff Company, and had Defendant U2Bio acquire human resources, effort, and expenses for the Plaintiff Company, various business data, research technology, sales, etc.

Shed legal doctrine

In order to establish a crime of occupational breach of trust, a person who administers another’s business obtains pecuniary advantage or has a third party obtain it from an act in violation of one’s duty and thereby inflict loss on the principal. In this case, “act in violation of one’s duty” includes any act in violation of a fiduciary relationship with the principal by failing to perform an act that is naturally expected under the provisions of law, the terms of a contract, or the good faith principle in light of the content and nature of the business, or by performing an act that is anticipated not to perform as a matter of course. In order to establish a crime of occupational breach of trust, the intention in breach of trust must be obtained and thereby inflict loss on the principal, i.e., awareness of the breach of fiduciary duty as a subjective element, and the awareness that the act is a subjective element, i.e., the intent in breach of fiduciary duty, even if the result of the act is on some part of one’s own interest, and cannot be denied if it is proved that the intent in such profit or loss was the principal (see, e.g., Supreme Court Decision 2004Do5204).

Meanwhile, if an employee of a company disclosed a trade secret to a competitor or ships it out without permission for the purpose of using it for his own interest, such act constitutes an occupational breach of trust, and even if it is not disclosed to many unspecified persons even if it is not a trade secret, and is a major business asset produced by an employer using considerable time, effort and expenses, the act of taking out the trade secret or the material which is a major business asset constitutes an occupational breach of trust. Even if the employee of the company lawfully takes out the trade secret or the material which is a major business asset and did not return it to the competitor or did not return it for the purpose of using it at the time of withdrawal, such act constitutes an occupational breach of trust (see, e.g., Supreme Court Decision 2008Do9433, Oct. 15, 2009).

In light of the above legal principles and the above facts and circumstances, Defendant 1 did not seek ways for the interests of the company, such as the company’s rehabilitation and acquisition, as the vice president of the Plaintiff Company’s main business division, rather than seeking ways for the company’s interests as a vice president. Under the premise of the bankruptcy of the Plaintiff Company which was not yet determined, Defendant 1 led Defendant 1, a representative director of the Plaintiff Company, to resign from the employees of the Plaintiff Company’s main business division, which was newly established by Defendant 2, and thereby making it impossible to perform the Plaintiff Company’s business itself constitutes an act of leaving a fiduciary relationship with the Plaintiff by failing to perform any act that is naturally expected to be done on behalf of the Plaintiff Company or by performing any act that is anticipated not to be done on behalf of the Plaintiff Company, under the terms of the contract or the good faith principle, or by taking any genetic testing conducted on the basis of the patent technology held by the Plaintiff Company, and the documents, cost table of genetic testing transactions, and unit price table of inspection items, etc., the Plaintiff Company’s act constitutes an act of breach of trust (see, 2014.).

Therefore, Defendant 1’s act of having the employees of the Plaintiff Company, including Nonparty 2, left the job with a major business asset, constitutes a tort as a occupational breach of trust where Defendant U2Bio gains profit by acquiring the Plaintiff Company’s personal assets and major business assets, and the Plaintiff Company suffered damages therefrom.

x) Accordingly, Defendant 1 is responsible for compensating the Plaintiff for damages caused by the aforementioned illegal acts.

B) Determination as to the claim against Defendant 2

(1) On the other hand, criminal liability for illegal acts is held liable for acts violating the legal order of society, and is subject to a public sanction against an actor. Civil liability is held individually responsible for infringing another person's legal interest, and thus, the compensation for damages incurred to the victim is based on the guiding principle. The compensation system is the equitable and reasonable burden of damages. Thus, even if the act does not constitute a criminal offense, whether it constitutes a tort under the civil law should be examined from a perspective separate from criminal liability (see Supreme Court Decision 2006Da6713, Feb. 1, 2008, etc.).

In addition, with respect to the joint tort under Article 760 of the Civil Code which causes damage to another person jointly, the joint tort is established without requiring not only the conspiracy among actors, but also the common perception of the joint tort. However, if the joint tort is objectively related to the joint tort, it is sufficient if the joint tort occurred, and the damage is caused by the related joint act, and the joint tort refers to all direct and indirect acts that facilitate the tort, and aid and abetting the joint tort refers to all acts that facilitate the tort, and it is possible to assist by negligence as an interpretation of the Civil Code that considers the negligence as a matter of principle for the purpose of compensating for the damage, unlike the Criminal Code. In this case, the content of the negligence refers to a violation of this duty on the premise that there is a duty of care not to assist the tort (see Supreme Court Decision 2009Da80026, Feb. 11, 2010, etc.).

The following facts or circumstances are acknowledged in light of the evidence mentioned above and the evidence mentioned in Gap evidence No. 4-11, 13, 43, 60, 68, 80, 82, 83, 88, 90, 91, Eul evidence No. 2-4, 5, 7, 18, 29, and 30, respectively.

① Defendant 2 obtained all the information on the financial status, operational status, etc. of the Plaintiff Company in the course of discussions on the merger and acquisition of the Plaintiff Company. Around November 2008, Defendant 2 suggested to Nonparty 1 separate acceptance of the Plaintiff Company’s main business division among the Plaintiff Company, and made a separate payment of living expenses and other self-reliance expenses in the Nonparty 1’s future (the Nonparty 1 demanded Defendant 2 to refuse to pay KRW 500 million to the Plaintiff Company’s main business division, and argued that there was a 1 billion won of the Plaintiff Company’s main business division, and that there was a 500 million won of the Plaintiff Company’s main business division, and Defendant 2 suggested that Nonparty 1 would be able to receive KRW 500 million of the Plaintiff Company’s main business division, and that Nonparty 1 would not be able to receive for self-reliance expenses for up to 3 years in the process of the Plaintiff Company’s new business division in February 1, 208).

② On December 2008, Defendant 1 and Nonparty 3, Nonparty 4, Nonparty 5, and Nonparty 5, who are the executive officers of the Plaintiff Company, met the deputy head, and Defendant 2 agreed to work at the Plaintiff Company’s level of SK level of wages, etc. and recommended the severance from employment. On that spot, Defendant UBcare’s 9 director (business director) and Nonparty 8’s vice head (the head of the UB planning team leader) participated together.

③ In the process of seeking to establish a new company and employ the Plaintiff’s employees as above, Defendant 2 did not only notify Nonparty 1 of this fact, but also did not take an official process of confirming whether the bankruptcy of the Plaintiff company was decided, and whether there was any problem in the employee’s severance from employment. In addition, Defendant 1 stated in the investigative agency that Defendant 2 instructed Nonparty 1 to notify Nonparty 1 of the fact that the recruitment of the Plaintiff’s employees was in a situation such as the purchase of the Plaintiff’s main business affairs, which negotiated with Nonparty 1, as a result, once Nonparty 1 became aware of the employment of the Plaintiff company’s employees from the standpoint of Defendant 2.

④ Defendant 2, at the investigative agency, was the person in charge of funding and organizational network, and was supported by Defendant 1, both technology, equipment, human resources, etc., and Nonparty 1, who was before the Plaintiff Company’s employees, was notified of bankruptcy officially, completed the registration of establishment of Defendant U2Bio and completed the preparation for opening business, such as the lease of office.

⑤ At the time of the establishment of U2Bio in January 2009, Nonparty 6 was registered as the representative director on the certified copy of the register and the business registration certificate of U2Bio, but Nonparty 6 was merely a nominal representative director. Defendant 2 operated U2Bio as the actual representative director. Defendant 2 was operating the U2Bio as the Defendant’s representative director. Defendant 2 used the internal computer system of U2Bio to approve the Defendant’s building. After the instant lawsuit was filed, Defendant 2 resigned from the office as the representative director of U2Bio and left the office from November 2009 to the office of Defendant U2Bio’s representative director.

④ Defendant 1, who directly participated in the establishment of Defendant U2Bio, was employed as the vice president of Defendant U2Bio. From January 2009 to January 10, 2009, Defendant 1 paid wages or sales-related expenses to the account of the name of “,” and Defendant 2 and Defendant 1 sent written approval even during the intra-company mail inside U2Bio, with the name of both Defendant 2 and Defendant 1 not revealed. However, if Defendant 2 was duly established, and Defendant 1 was employed by justifiable means, there seems to be no reason to use the name of the car.

7. At the time of the establishment of the Defendant U2Bio, there was no professional employed by the Plaintiff Company, except for those employed by the Plaintiff Company.

8) In particular, Defendant 2 participated and explained that “U2BE in U2E in U2O” 2009 (“A evidence No. 4-13), “The business plan following the revision of the inspection institution, among the business plan of U2Bios, is indicated as follows: January 15 through January 31: the employee (the team leader level) who was in charge of the actual management of U2Bio directly visits the inspection institution to explain the transfer of the inspection institution from February 1, 200; to explain the relocation of the inspection institution from February 1 to February 15, 200; and to explain that there is no problem in the management of the inspection level. On February 1 to February 15, 200: The current business division collected the inspection materials from the current business division to the Plaintiff company (acquisition transfer); it appears to have been changed to the Plaintiff company’s business operator’s prior to the date of January 2, 209 to the Plaintiff company’s business operator’s prior to the date of the inspection.”

9) Defendant 2 knew that Nonparty 2 stolen PCR machinery, which is a genetic testing device, from the Plaintiff Company, but did so.

(10) In order to publicize the Plaintiff Company, there was a book that contains the description of the Plaintiff Company’s patented invention of this case and the difference between the method of detection and other methods (No. 4-90). Around February 2009, Defendant U2Bio created the Plaintiff Company’s book without entirely notifying the Plaintiff Company of the content of the book, and made the Defendant U2Bio’s publicity book (No. 4-91-2 of the evidence No. 4-2 of the Plaintiff Company) and pretended that Defendant U2Bio was developing and implementing the said patent technology, and Defendant 2 also seems to have been aware of such circumstances.

11. As seen earlier, materials such as the list of customers taken out by Nonparty 2 and managed by the Plaintiff Company, the results of genetic testing, the cost table for genetic testing transactions, and the unit price table for the test item were utilized in U2Bio as they were, and Defendant 2 also seems to have been aware of such circumstances.

(12) Defendant 2 asserts to the effect that the Plaintiff Company went bankrupt and carried out its business on the part of Defendant 1. However, it is difficult to believe that Defendant 2 did not confirm the bankruptcy of the Plaintiff Company, and Defendant 2 did not believe that the Plaintiff Company was properly recruited the Plaintiff Company’s employees by reliance on Defendant 1’s horse that the Plaintiff Company went bankrupt only one month after the conclusion of the merger and acquisition agreement with Nonparty 1 under the circumstances where it is impossible to establish the Plaintiff Company’s human resources and material assets without any change.

【Defendant 2’s failure to establish Defendant U2Bio without any employee or asset of the Plaintiff Company’s metrative business division is deemed to have actively participated in the act of occupational breach of trust by allowing Defendant 2 to withdraw the employees of the Plaintiff Company’s metrative business division to the Defendant U2Bio and to remove the Plaintiff Company’s major business assets to be used in the business of U2Bio, on the premise of the Plaintiff Company’s bankruptcy that was not yet determined.

In addition, Defendant 2 suggested Defendant 1 to leave the Plaintiff Company’s employees to the Defendant U2Bio, etc., grant Defendant 1 a motive to leave the Plaintiff Company’s employees as an occupational breach of trust, and even if Defendant 1 could have been aware of the Plaintiff Company’s employees’ act of occupational breach of trust due to his severance and removal of major business assets during the process of the establishment of U2Bio, it may be deemed that Defendant 1 assisted and abetted Defendant 1’s act of occupational breach of trust at least by intention or negligence.

x) Accordingly, Defendant 2 is jointly with Defendant 1 in accordance with Article 760 of the Civil Code to compensate for the damages of the Plaintiff Company caused by joint tort of occupational breach of trust against the Plaintiff Company.

C) Determination on the claim against Defendant UBcare

(1) On the other hand, it is reasonable to interpret that the representative director is liable to compensate for damages due to the illegal acts of the representative director under Articles 389(3) and 210 of the Commercial Act, if the representative director causes damages to the other party. The "in this context, due to the execution of business" does not belong to the representative director's business itself, but it includes the case where the representative director is observed from the external appearance of the act and is deemed to belong to the representative director's business scope. Thus, if the act is deemed to be the business execution of the representative director's representative director's representative director's business operation, the representative director's liability for damages should be recognized even if it is intended to pursue the personal interests of the representative director or it is in violation of the law (see Supreme Court Decision 2003Da6707 delivered on February 25, 2005).

The facts that Defendant UBcare officially inspected the merger and acquisition of the Plaintiff Company or discussed it at the board of directors, as alleged by the Defendant UBcare, are not found. However, in full view of the following circumstances revealed by the facts and evidence revealed earlier in light of the aforementioned legal principles, it is reasonable to deem that the above acts by Defendant UBcare are objectively for the business activities or business performance of Defendant UBcare at least for the external appearance. As such, Defendant UBcare is liable to compensate the Plaintiff Company for the damages incurred by the Plaintiff Company due to the above acts by Defendant UBcare, the representative director.

① Defendant 2 had been continuously maintained the status of the representative director of UBcare at the time of Non-Party 1’s proposal for the merger and acquisition of the Plaintiff Company, and around the time when the employees of the Plaintiff Company were met to establish UBcare, Defendant 2 had continuously maintained the status of the representative director of UBcare at around October 2009.

② As seen earlier, around December 2008, Defendant 2 participated in the Plaintiff Company’s executive officers on December 2008, Nonparty 9’s business director and Nonparty 8’s team leader, etc. In addition, if Defendant 2 personally starts up a business, as alleged by Defendant UBcare, the executive officers of Defendant UBcare did not appear. Nonparty 7 (Financial Team leader), an employee of Defendant UBcare, is in charge of the accounting management and fund-raising management related to Defendant UBcare’s finance, and Nonparty 8 (Personnel Team leader) is practically involved in the management of Defendant UBcare by performing the duties such as the interview of new employees and the management of welfare parts of employees.

③ Defendant UBcare is a representative company operating EMR (Elecreced draft and electronic medical record), which is a EMR service (e.g., integration of tasks from the patient’s receipt to the patient’s diagnosis, inspection, claim, and receipt), and has secured a domestic maximum hospital and pharmacy network. Defendant UBcare is incorporated into an affiliate company of SKB medicine, and is in a state of being in the position of a stronger in U-HH market in the future. As such, Defendant U-Hcare’s series of actions during the process of establishing Defendant UBcare’s representative director is objectively related to the business activities of Defendant UBcare, and there is sufficient room to regard Defendant UBcare’s representative director as the performance of duties.

④ Around December 1994, Defendant UBcare established and operated UBcare as a representative director with Defendant UBcare as a company No. 1 company for intra-corporate venture business. Around December 2004, the Credit Group became the major shareholder of the Defendant UBcare, and around April 2008, Defendant UBcare prepared to establish the Defendant UBcare as an independent shareholder, and Defendant UBcare established under its understanding by reporting it to the president of the SB Group and reporting it to the president of the SB Group. However, it is difficult to understand that the representative director of UBcare, who is the listed company, was the vice president of the group under his control to establish another company which can become a competitor, or that the representative director of the existing UBcare has to continue to perform his duties for more than one year.

⑤ Since the establishment of U2Bio, Defendant U2Bio acquired 40,000 shares of Defendant U2Bio on December 28, 2009, in total of KRW 5,000 per share, and KRW 200,000 per share, and held an amount equivalent to 4.54% of its equity ratio.

x) Accordingly, Defendant UBcare is liable for damages to the Plaintiff Company in accordance with Articles 389(2) and 210 of the Commercial Act.

D) Determination as to Defendant U2Bio’s claim

(1) Article 756 of the Civil Act provides that “When an employee’s unlawful act is objectively deemed to be an employee’s business activity, an act of office performance, or an act of office performance, or an act of office performance, without considering the actor’s subjective circumstances. Whether it is objectively related to an employee’s work and tort, and whether it is objectively related to an employee’s work performance should be determined by considering the degree of relationship with the employee’s original duty and tort, as well as the degree of liability for causing damage to the employee and for failing to take preventive measures (see, e.g., Supreme Court Decisions 86Meu1923, Nov. 22, 198; 2010Da20211, Jul. 22, 2010).

In addition, the relationship between the employer and the employee under Article 756 of the Civil Act is not necessarily limited to the case where there is an effective employment relationship, and even in the case where a person actually executes a business on behalf of another person according to his/her intention under the direction and supervision, he/she can be deemed to have an employment relationship between the two persons (see Supreme Court Decision 2010Da48387, Oct. 28, 2010, etc.).

D. In light of the aforementioned legal principles, Defendant 1’s act of occupational breach of trust as seen earlier, i.e., (i) established January 2, 2009 due to Defendant 1’s act of occupational breach of trust as seen earlier; (ii) committed a tort due to Defendant 1’s act of occupational breach of trust, such as leaving the Plaintiff’s employees or taking out major business assets after its establishment; and (iii) received wages and sales expenses from Defendant U2Bio from January 2009 to Defendant U2Bio’s account; and (iv) as seen earlier, Defendant 1 appears to have been objectively related to Defendant 1’s occupational breach of trust. Thus, it appears that Defendant 1’s duty of care and supervision was objectively related to Defendant 1’s occupational breach of trust. Thus, even if Defendant 1’s employment relationship with U2Bio was not established between Defendant 1 and U2Bio, Defendant 1’s duty of care and supervision was objectively related to Defendant 1’s occupational breach of trust.

Article 756 of the Civil Code, which is derived from Defendant U2Bio, shall be liable as an employer for the damages of the Plaintiff Company caused by Defendant 1’s illegal act.

E) Sub-decision

Ultimately, the Defendants are liable to compensate the respective Plaintiff for damages caused by the tort as seen earlier.

(b) Scope of damages;

1) Summary of the parties’ assertion

A) The plaintiff's assertion

The Plaintiff Company has no choice but to completely suspend its normal business due to the Defendants’ tort. The Plaintiff Company’s corporate value is ① KRW 24 billion presumed by the corporate value presumption report (hereinafter “corporate value report”) on the Plaintiff Company prepared by the Sejong Accounting Corporation, ② KRW 12 billion presented by the Plaintiff Company as acquisition price, ③ KRW 8.7 billion, which is the amount equivalent to the Plaintiff Company’s future net business profit, ④ KRW 3.7 billion, which is the amount equivalent to the Plaintiff Company’s future net business profit, ④ the amount equivalent to the Plaintiff Company’s total business profit, ④ KRW 3.6 billion, the amount equivalent to the Plaintiff Company’s total business profit, ④ KRW 2.9 billion, the amount equivalent to the Plaintiff Company’s total business profit, ④ KRW 3.6 billion, the amount equivalent to the Plaintiff Company’s total business profit, ④ KRW 2.9 billion, the amount equivalent to the amount equivalent to the Plaintiff Company’s previous total business profit, ④ KRW 3.6 billion, the amount equivalent to the Plaintiff Company’s total business profit, and KRW 29.7.5 billion.

B) The defendants' assertion

There is no causal link between the severance from employment of the employees of the Plaintiff Company and the bankruptcy status of the Plaintiff Company, and the Plaintiff Company did not intend to operate the Company any longer even without the instant actions by Defendant 1 and Defendant 2. In addition, there is no basis for the amount of damages claimed by the Plaintiff after the establishment of Defendant U2Bio, and there is no basis for the amount of damages claimed by the Plaintiff.

2) Determination

A) In a claim for damages arising from a tort, where it is recognized that the occurrence of property damage has occurred, but it is difficult to prove the specific amount of damage in light of the nature of the case, the court may determine the amount of damage which is the scope of proximate causal relation by taking into account all the indirect facts such as the relationship between the parties revealed by the result of examination of evidence and the purport of pleading, the background leading up to the occurrence of property damage, the nature of damage, and all the circumstances after the occurrence of damage (see, e.g., Supreme Court Decision 2004Da48508, Nov. 24, 200

B) The following facts and circumstances can be acknowledged in light of the overall purport of the arguments as a result of the inquiry into the facts as seen earlier, the evidence as seen earlier, the testimony of Non-Party 12, the testimony of Non-Party 12 of the witness of the first instance trial, the Seongbuk-do Tax Office, the Macheon Tax Office, the National Tax Service, the North Incheon Tax Office, and the fact-finding as to the distribution tax office.

① From April 2008 to delay the payment of wages to its employees and around October 2008, the Plaintiff Company assumed a large amount of obligations, such as long-term loans and overdue payment. During this process, Nonparty 1 did not take any particular measures to resolve the problem of delayed payment of wages to its employees and did not temporarily contact with its employees.

② The Plaintiff Company consists of the bio-business division and the mechanical business division. While the main business division continues to pay profits, the bio-business division has reduced the overall financial situation of the Plaintiff, which led to the aggravation of the overall financial situation of the Plaintiff, and around October 2008, the part of the bio-business division was adjusted by withdrawing all the employees of the bio-business division.

③ Nonparty 1, in order to overcome the above financial difficulties, was conducting negotiations on acquisition and merger with the Plaintiff Company. At the time of negotiations on acquisition and merger with Defendant 2, Nonparty 1 recognized that the Plaintiff Company was in full capital potential, most of the inventory assets of the Plaintiff Company constituted processed assets, and that the depreciation, depreciation of research funds, and inventory assets incurred a loss of KRW 1.7 billion upon depreciation.

④ According to the credit assessment information provided by the NICE Information Company, the credit assessment section of the Plaintiff Company was rated 8 August 2005, 2006, 7, and 2007, but was rated 7 or 8, and was extremely poor or highly poor.

⑤ On December 14, 2009, the corporate value report presented by the Plaintiff Company as the basis for calculating the amount of damages was prepared retroactively on June 30, 2008 to calculate the amount of damages for accusation against Defendant 1, Defendant 2, etc. at the request of Nonparty 13, a shareholder of the Plaintiff Company, on December 14, 2009, based on the Plaintiff Company’s business plan in 2008 through 2010, prepared and submitted by the Plaintiff Company without conducting an actual inspection or audit of the Plaintiff Company in accordance with the corporate accounting standards, without conducting the above report. The above report is also written in the above report’s purport. The above report’s content is also written without reflecting the Plaintiff Company’s sales data for the first half-yearly sales in 2008 or the circumstances on which the Plaintiff Company’s second half-yearly business of October 2008, it cannot be calculated on the basis of the corporate value of the Plaintiff Company.

6. In addition, the amount claimed by the Plaintiff Company as damages equivalent to corporate value is merely based on presumption or subjective interpretation, not based on objective evidence, and thus, it is difficult to calculate the amount of damages suffered by the Plaintiff Company due to the tort committed by Defendant 1 and Defendant 2.

7) As seen earlier, Defendant 1 transferred part of the Plaintiff Company’s human and physical organization to U2Bio, and continuously acquired operating profits from the Plaintiff Company’s existing business partners by utilizing the patent technology owned by the Plaintiff Company and the genetic testing result documents, cost table of genetic testing transactions, unit price table of test items, and business data, and the employees of the Plaintiff Company having the ability to conduct the inspection to U2Bio. In fact, Defendant 1 transferred the Plaintiff Company’s human and physical organization to U2Bio, and continuously acquired operating profits from the Plaintiff Company’s existing business partners. However, Defendant U2Bio also seems to establish a nationwide business agency of U2Bio by utilizing the nationwide business agencies of U2Bio.

④ As of December 2008, the customer of the Plaintiff Company appears to be at least 162 persons. As of March 2010, the customer of the Plaintiff Company appears to be in transactions with the Plaintiff Company, including the customer of the Plaintiff Company, as of March 2010. According to the report of value-added tax from March 2009 to 2012 of the Defendant U2Bio, it is difficult to separately calculate the sales of the Plaintiff Company’s existing customer of U2Bio as of March 2010 due to the occurrence of sales with the Plaintiff Company’s newly expanded customer other than the existing customer of the Plaintiff Company.

① Even if Defendant 1 had the authority to deceiving Nonparty 1 and deliver a written permission to resign to the employees of the Plaintiff Company, it eventually enables Nonparty 1 to resign from employment by preparing and delivering a written permission to resign from employment. Nonparty 1 also appears to have declared the Plaintiff Company’s bankruptcy before recognizing Defendant 1’s act of breach of trust. However, Nonparty 1 was in a situation where Nonparty 1 was making efforts to merge with another company. The Plaintiff Company’s main business structure of the Plaintiff Company’s company’s main business structure entered the gene test every day and handled the work every day. Thus, if there is no employee, the company’s operation was immediately suspended and the employee’s continuous attendance is an important part for the existence of the company. Thus, it is difficult to readily conclude that the Plaintiff Company was bankrupt even if Defendant 1 and Defendant 2 did not have any tort.

(10) Even if the Plaintiff Company was a financial state and was bankrupt, if the financial status of the Plaintiff Company was worse due to the tort committed by Defendant 1 and Defendant 2, it is reasonable to view that proximate causal relation is recognized as well.

In full view of the aforementioned legal principles and the facts and circumstances as seen earlier, there is a proximate causal relation between the tort committed by Defendants 1 and 2 and the damages equivalent to the Plaintiff Company’s corporate value or the amount equivalent to the Plaintiff Company’s operating profit. In this case where it is difficult to prove the specific amount of damages of the Plaintiff Company due to the tort committed by Defendants 1 and 2 in light of the above circumstances, it is reasonable to determine the amount of damages as KRW 500 million by comprehensively taking into account all the circumstances such as the background leading up to the occurrence of the tort in this case and its property damage, the nature of the damage, and the circumstances immediately before the Plaintiff was bankrupt at the time of the Plaintiff Company’s acquisition negotiation, while Defendant 2 presented KRW 500 million to the Plaintiff at the time of the Plaintiff Company’s acquisition, on the other hand, the entire personnel and material parts of the Plaintiff Company’s main business assets, not as a whole, and only some employees and major assets have been transferred to Defendant U2Bio.

3) Sub-determination

Therefore, the Defendants are obligated to pay damages for delay calculated at each rate of 20% per annum as stipulated in the Civil Act from April 30, 201 to April 2, 2011; Defendant 2 from April 2, 2011; Defendant UBcare from March 23, 2011 to March 24, 2011; and from March 24, 2011 to March 20, 201, from March 201 to March 20, 201, each of the Defendants is deemed reasonable to dispute over the existence and scope of the Defendants’ obligations.

3. Judgment on the conjunctive claim

A. Summary of the parties' assertion

1) The plaintiff's assertion 3) Summary

A) Defendant 1, Defendant 2, U2Bio, Plaintiff Company’s employees, and inspection machinery, etc. used the Plaintiff Company’s patented invention as it is and directly infringed the Plaintiff Company’s patent right. Claims for patent of the instant patent invention filed by the Plaintiff Company are claims 1 through 9, and claims 1 through 8 are claims 1 and claims 1 through 8 are subject to patent protection, respectively. The Defendants performed diagnosis and inspection using the same method as patent invention under paragraph (1).

Defendant U2Bio implemented the patented invention under paragraph (1) of the above claim of the Plaintiff Company without permission, and Defendant 1 cooperateed with it. Defendant 2, as the representative director of U2Bio, proposed the severance from employment of the Plaintiff Company’s employees. Defendant 1 had Defendant 1 practice the patented invention under paragraph (1) of the above claim of the Plaintiff Company or infringed the patent right by allowing Defendant 1 to practice the patented invention under paragraph (1) above or impliedly.

B) ① Under Article 128(2) of the Patent Act, the amount of damages of the Plaintiff Company is the amount of profit of Defendant U2Bio. The amount of profit of Defendant U2Bio continues to increase, and it is reasonable to deem that the damages suffered by the Plaintiff Company constitute the amount of income calculated by multiplying the standard income rate by 4) the amount of profit, not the profit on the profit and loss statement of Defendant U2Bio. From 2009 to 2012, the total sales amount of KRW 14,908,923,949 from 2009 to 2012 was the amount of total sales amount of KRW 19,514,515,510,530, total sales amount of the corporations established and operated by Defendant U2Bio by region (other than 12 weeks). Accordingly, the amount calculated by multiplying the standard income rate of 22% by the amount of profit and loss, which is part of the damages of the Plaintiff Company.

② Even if such damages are not acknowledged, the Plaintiff Company may claim for patent license fees from Defendant U2Bio, who is conducting patent technology without permission as a patentee, as compensation for damages. As seen earlier, the Plaintiff Company offered a proposal of KRW 1 billion at the time of the acquisition negotiation of the Plaintiff Company. As such, the amount of damages that Defendant U2Bio should pay by implementing the Plaintiff Company’s patent technology is at least one billion.

③ If the patent infringement period of the patent right of this case was calculated from January 2, 2009, which was established by U2Bio, to October 24, 2009, from January 24, 2009, from which the patent right of this case was extinguished, the profit earned by U2Bio during the above period is a total of 468,959,779 won (2,628,727,787 won x 296/365 x 0.22). The Plaintiff Company suffered the same loss, and the Defendants should compensate for the said amount at least 468,959,779 won.

2) Summary of Defendant 1, Defendant 2, and U2Bio’s assertion

A) The scope of the Plaintiff Company’s patent right should only extend to the production or use of multiple sexual diagnosis products containing all flasing machines under Paragraph (1) of the patent right of this case. The scope of the Plaintiff Company’s patent right does not extend to the diagnosis of sexual diseases using only a part of the four kinds of flas, or the diagnosis of sexual diseases by individually using four kinds of flas.

B) Around April 30, 2009, the Plaintiff Company informed Defendant 1 and Defendant 2 to an investigative agency of the infringement of the patent right of this case. However, only on May 28, 2013, it was evident that three years have passed since it filed a claim for damages arising from a tort on the ground of patent infringement. As such, the Plaintiff’s claim for damages arising from the tort of this patent infringement had already expired.

B. Determination

1) The scope of protection of a patented invention shall be determined by the descriptions of the claims, and a claim that contains a description that is indispensable for the composition of the invention. Thus, the matters stated in the claims shall be deemed an essential element of the invention, barring any special circumstance. In a case where the claims of a patented invention are composed of multiple elements, it does not protect each element independently. Thus, in a case where the invention compared to the patented invention has only some of the essential elements indicated in the claims of the patented invention, and lacks the remaining elements, the invention, in principle, does not fall under the scope of the right of the patented invention (see Supreme Court Decision 98Hu2856, Jun. 1, 2001, etc.).

(ii) the facts of recognition

If Gap evidence No. 13 and Eul's evidence No. 42 are gathered to the purport of the whole pleadings, the following facts may be acknowledged:

A) The descriptions of Claim 1 in the specification of the instant patent invention are as follows.

Paragraph 1 of paragraph 1 of the table contained in the main text, 'multi-specific disease creations containing 3GT-Grheat fever (PCR) : 1) fixed direction francasia and 2 book heating numbers : 1: 5'CGTGTATGTGTGTGGTGGGTPPPPPPPPG number 2: 5's fixed direction 5'TCCGGGGGGR number 3GMM-GGM number 3GGM number 4'; 5'MGM number 3'GMMMM 5's 4'GMM method

B) The Plaintiff Company’s patent right is an invention of its name “the key key method for diagnosis of multiple sexual diseases and the method of detecting sexual disease cause germs using the key method.” Claim 1 is based on the medium pressure and efficacy chain chain reaction test (PCR test). The purpose of the Plaintiff Company’s patent right is to detect 4 major cause germs of sexual diseases at one time by manufacturing a new sexual disease diagnosis key method added to multi-party diagnosis function, and to reduce the time of the diagnosis drastically, and to improve the accuracy and awareness of the result of the diagnosis.

3) If we look at the overall purport of the pleadings as a result of the fact-finding of the fact-finding on the COSTTT, Gap evidence Nos. 27, Eul evidence Nos. 47-1, 2, and 50, Eul evidence Nos. 47-2, and Eul's evidence Nos. 50, and Eul's fact-finding on the COSTTT, it is recognized that, in light of the fact that part of the contents of the gene reagents ordered by EOSTTTTTT, which was registered by the plaintiff, are identical to the west Nos. 5, 6, and 5, and 8 as the west No. 1 in the claim No. 1, and that part of the contents of the gene reagents registered by the plaintiff were supplied by the defendant OMTTTTTTT, which is identical to the

Meanwhile, according to the above legal principles and facts, the scope of protection of the plaintiff company's patented invention of this case is as follows: (a) claim 1 provides multiple sexual disease diagnosis products containing PC reaction(PCR), which show 4 kinds of chlostal disease causes of each chlostal fever No. 1 through No. 8; and (b) in light of the name of the patented invention of this case and the description of the above claim, four kinds of dlostals (Chlamas) (hereinafter referred to as Elostaltyis), flostalo (hereinafter referred to as Neisia grhoeae), flostal disease, galphalmosis, lelostalmopic malmopic typhom, and each part of the above blostal blostal boms and other blostal boms are not used to detect multiple blostal bom, which are individually used to detect multiple blostalo.

However, the above facts and evidence alone are insufficient to recognize that Defendants 1, 2, and U2Bio infringed the Plaintiff Company’s patented invention under the above claim No. 1 by producing and using multiple sexual diagnosis products containing all of the aforementioned four kinds of plastic machines, etc., and there is no other evidence to prove otherwise.

Therefore, Defendant 1, Defendant 2, and U2Bio violated the Plaintiff’s patented invention, the Plaintiff’s above assertion based on the premise that the Plaintiff infringed the Plaintiff’s patented invention is not acceptable without further review.

4. Conclusion

If so, the plaintiff's primary claim of this case is accepted within the above scope of recognition, and all of the remaining primary claims and conjunctive claims are dismissed as they are without merit. The judgment of the court of first instance is justified in some different conclusions, and it is so decided that the judgment of the court of first instance, including the conjunctive claim added in the trial, will be modified as above. It is so decided as per Disposition.

Judges exhaustion fever (Presiding Judge) Kim Jong-chul

(1) In the statement of grounds of appeal dated February 28, 2013, the Plaintiff asserted that “for the same business as the Plaintiff Company, due to Defendant 1 and Defendant 2’s illegal act, the Plaintiff succeeded from the Plaintiff Company the personal and physical organization of the Plaintiff Company having economic value without any consideration (no legal basis), and that the Plaintiff Company constitutes unjust enrichment in relation to the Plaintiff Company, and thus, constitutes unjust enrichment, the Plaintiff Company was obligated to return money equivalent to the above personal and physical organization’s profits arising from the succession to the said human and physical organization. However, the Plaintiff did not file a claim for return of unjust enrichment while changing and arranging the cause of the claim in the preparatory document dated May 28, 2013. Therefore, the above assertion for return of unjust enrichment against Defendant U2Bio is deemed to have been withdrawn. Therefore, it is not determined separately.

2) If a member representing a company under Article 210 (Liability for Damages) of the Commercial Act causes any loss to another person in the course of performing his duties, the company shall be jointly and severally liable with such member.

3) If the damages incurred by the primary claimant’s tort of this case are less than the damages incurred by the primary claimant’s infringement of patent rights, the purport is to request the determination of the conjunctive claim for the same portion.

4) The ratio of net income calculated by subtracting total expenses from annual gross sales.

Note 5) Prier: Subdivision, which serves as the basis for the reproduction of a molecule of the same kind, and Pririer, is one of the DNA part of the DNA part intended to be used as a principal type in order to increase selectively to determine the fluor part of the specific fluor by PC techniques, which is about approximately 20bp from the end of both parts of the DNA end of each part of the DNA part intended to be used as a principal type in order to increase the fluor’s fluor’s fluor’s fluor’s fluor’s fluor’s fluor’s fluor’

6) In addition, the Plaintiff asserts to the effect that the use of Defendant U2Bio’s instant patent infringement requirements cannot be deemed as an indirect infringement of patent rights, even though it did not meet the requirements for Defendant U2Bio’s direct infringement of patent rights in the text of reference on February 17, 2014, which was submitted after the closing of argument at the trial. However, as seen earlier, the Plaintiff’s assertion that Defendant U2Bio’s act of using Defendant U2Bio’s instant claim Nos. 5 through 8 constitutes an indirect infringement of patent rights. However, even if Defendant U2Bio purchased Ras with the same base heat as the base heat Nos. 5, 6, 7, and 8 of Defendant U2Bio’s claim No. 1, as seen earlier, even if Defendant U2Bio purchased Ras with the same base heat Nos. 5, 6, and 7, and 8 cannot be deemed as a product used only for the implementation of the instant patent invention. Thus, the Plaintiff’s assertion that the aforementioned act constitutes an indirect infringement under Article 127 of the Patent Act is without merit.